Skip Navigation
Skip to contents

Journal of Microbiology : Journal of Microbiology

OPEN ACCESS
SEARCH
Search

Articles

Page Path
HOME > J. Microbiol > Volume 39(1); 2001 > Article
Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae
Hee Jong Kim , Youn Su Lee
Journal of Microbiology 2001;39(1):56-61.

Division of Applied Plant Sciences, College of Agriculture and Life Sciences, Kangwon National University, Chuncheon 200-701, Kangwon, Korea
Corresponding author:  Youn Su Lee , Tel: 82-33-250-6417, 
prev next
  • 64 Views
  • 0 Download
  • 0 Crossref
  • 0 Scopus

Plasmodiophora brassicae is an obligate parasite, a causal organism of clubroot disease in crucifers that can survive in the soil as resting spores for many years. P. brassicae causes great losses in susceptible varieties of crucifers throughout the world. In this present study, an in planta molecular marker for the detection of P. bassicae was developed using an oligonucleotide primer set from the small subunit gene (18S like) and internal transcribed spacer (ITS) region of rDNA. The specific primer sequences determined were TCAGCTTGAATGCTAATGTG (ITS5) and CTACCTCATTTGAGATCTTTGA (PB-2). This primer set was used to specifically detect P. bassicae in planta. The amplicon using the specific primer set was about 1,000 bp. However, the test plant and other soil-borne fungi including Fusarium spp. and Rhizoctonia spp., as well as bacteria such as Pseudomonas spp. and Erwinia spp. did not show any reaction with the primer set.

  • Cite this Article
    Cite this Article
    export Copy Download
    Close
    Download Citation
    Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

    Format:
    • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
    • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
    Include:
    • Citation for the content below
    Development of an In Planta Molecular Marker for the Detection of Chinese Cabbage (Brassica campestris ssp. pekinensis) Club Root Pathogen Plasmodiophora brassicae
    J. Microbiol. 2001;39(1):56-61.
    Close
Related articles

Journal of Microbiology : Journal of Microbiology
TOP